Journal: Frontiers in Molecular Neuroscience

Article Title: The Networks of Genes Encoding Palmitoylated Proteins in Axonal and Synaptic Compartments Are Affected in PPT1 Overexpressing Neuronal-Like Cells

doi: 10.3389/fnmol.2017.00266

Figure Lengend Snippet: The compendium of CLN1 overexpressing SH-SY5Y neuroblastoma cell lines used in the study.

Article Snippet: The expression of CLN1 was assessed by qPCR using inventoried Taqman assay (Hs00165579_m1; Applied Biosystems, LT), and normalized to the level of GAPDH (Hs99999905_m1) using the comparative Ct method.

Techniques: Transfection, Plasmid Preparation

Journal: Frontiers in Molecular Neuroscience

Article Title: The Networks of Genes Encoding Palmitoylated Proteins in Axonal and Synaptic Compartments Are Affected in PPT1 Overexpressing Neuronal-Like Cells

doi: 10.3389/fnmol.2017.00266

Figure Lengend Snippet: Characterization of CLN1 mRNA and corresponding Palmitoyl-Protein Thioesterase 1 (PPT1) protein expression in CLN1 transfected cells. (A) qRT-PCR quantitation of mRNA expression in transfected CLN1 cells. All transfected cells showed an increased expression of CLN1 mRNA ranging from 5 to 15 fold change in comparison to the endogenous level in controls (both parental and empty vector pcDNA3, mock-transfected cells). Mean ± SEM of three independent experiments; One-way ANOVA followed by Bonferroni’s multiple comparison test; *** p < 0.001. (B) Double immunofluorescence (IF) assay for PPT1 (green) and the lysosomal marker LAMP2 (red) revealed a strong signal of PPT1 in cells which stably expressed either wt CLN1 (b and c) or two different missense mutations (p.L222P, e and f; p.V181L, h and i). Empty vector expressing cells (a), the CLN1 insertion (p.M57Nfs*45, d) and the CLN1 deletion (p.G42_E78del, g) are shown in comparison. A partial localization inside lysosomes was observed for SH-p.wtCLN1 (inset in c), whereas a more diffuse cytoplasmic pattern was detected for SH-p.L222P and SH-p.V181L (f and i). Nuclei are marked by white asterisks; scale bars equal to 20 μm (h) and 10 μm for insets (c, f and i). Colocalization is shown in yellow. (C) Overexpression of PPT1 in both SH-p.wtCLN1 cells and cell lines harboring a missense mutation was confirmed by immunoblotting analysis. The 38–36 kDa doublets were detected in homogenates of wt CLN1 cells. A different pattern was associated with the missense mutation-bearing proteoforms of PPT1- a single band, running approximately at 41 kDa, was detected in homogenates of these CLN1 mutants only. In cells transfected with indel mutations, the 38–36 kDa doublets could be identified following high exposure only, suggestive for a representation of the endogenous PPT1 signal. NT, non-treated; all-trans Retinoic Acid-Neurobasal medium (RA-NBM), differentiated cells. (D) Strong increase in PPT1 enzymatic activity (EA) was observed in SH-p.wtCLN1 as compared to SH-pcDNA3 empty vector cells (3-fold change). Parental SH-SY5Y and cell lines carrying different mutations demonstrated some variability in PPT1 EA, with less than 0.25 fold change in relation to the empty vector transfected cell line. Mean ± SEM of three independent experiments; One-way ANOVA followed by Bonferroni’s multiple comparison test; *** p < 0.001.

Article Snippet: The expression of CLN1 was assessed by qPCR using inventoried Taqman assay (Hs00165579_m1; Applied Biosystems, LT), and normalized to the level of GAPDH (Hs99999905_m1) using the comparative Ct method.

Techniques: Expressing, Transfection, Quantitative RT-PCR, Quantitation Assay, Comparison, Plasmid Preparation, Immunofluorescence, Marker, Stable Transfection, Over Expression, Mutagenesis, Western Blot, Activity Assay

Journal: Frontiers in Molecular Neuroscience

Article Title: The Networks of Genes Encoding Palmitoylated Proteins in Axonal and Synaptic Compartments Are Affected in PPT1 Overexpressing Neuronal-Like Cells

doi: 10.3389/fnmol.2017.00266

Figure Lengend Snippet: Palmitoylation gene/protein survey. (A) Venn diagram of identified palmitoylated gene products (palmitoylated proteins) among differentially expressed genes in the transcriptomic profiles of SH-p.wtCLN1, SH-p.L222P and SH-p.M57Nfs*45, compared to an empty-vector (SH-pcDNA3) expressing cells. The amount of identified DEGs is stated below the cell line name, whereas the numbers of genes shared among the three comparisons are reported in the intersections of the Venn diagram. Eighty-five of such genes were selectively expressed in SH-p.wtCLN1 only. See Supplementary Tables S4, S5, S6 for the compendium of genes of each CLN1 cell line and Supplementary Figure S4 for genes assigned to each interaction area of Venn diagram. (B) Twenty five genes, specifically expressed in SH-p.wtCLN1 cells, were connected to Nervous System Development and Function as well as to annotations related to neurites formations. Cell Component GO terms (PANTHER) were also linked. Notably, CTSD , associated with CLN10 disease was found to be up-regulated in wild-type PPT1 -overexpressing cells, further supporting a genetic interaction between these two neuronal ceroid lipofuscinoses (NCL) genes. For an exhaustive compendium of identified genes encoding the palmitoylated proteins and assigned IPA functions and GO terms see Table S7 in supplementary materials. Genes, marked by a black slash were further investigated for protein expression by Western Blotting (WB) analysis.

Article Snippet: The expression of CLN1 was assessed by qPCR using inventoried Taqman assay (Hs00165579_m1; Applied Biosystems, LT), and normalized to the level of GAPDH (Hs99999905_m1) using the comparative Ct method.

Techniques: Plasmid Preparation, Expressing, Western Blot

Journal: JCI Insight

Article Title: PPT1 inhibition enhances the antitumor activity of anti–PD-1 antibody in melanoma

doi: 10.1172/jci.insight.133225

Figure Lengend Snippet: ( A ) Schematic of priming and coculture experiments to measure antigen-specific T cell killing in vitro. ( B ) One hundred percent lactate dehydrogenase (LDH) from the coculture of primed or unprimed splenocytes with live B16, in the presence or absence of HCQ (10 μM). Each experiment was performed in triplicates, and results were reproduced with 3 independent experiments. Concanavalin A was used as a nonspecific splenocyte priming agent. ( C ) One hundred percent LDH measurement in primed splenocytes cocultured with B16 with/without indicated treatments. ( D ) Immunoblots confirming the B16 Ulk1 -, Pik3c3 -, and Atg7 -KD status. ( E ) Dot plot representing ELISA performed for the measurement of splenocyte-secreted IFN-γ upon coculturing with B16 with Ulk1 -, Pik3c3 -, and Atg7 -KD conditions. Each experiment was performed in triplicates, and the results were reproduced by 3 independent experiments. ( F ) Immunoblot confirming the B16 Ppt1 -KD status. ( G ) Dot plot representing IFN-γ ELISA in Ppt1 -KD B16 coculture as above in E for 3 independent experiments. ( H ) Measurement of percentage T cell–mediated cytotoxicity of B16 cells in Ulk1 , Pik3c3 , Atg7 , and Ppt1 condition. ( I ) Immunoblot confirming the B16 Atg7 -KO status. ( J ) Irradiated B16-primed splenocytes or purified splenic CD8 + T cells were cocultured with B16 WT Atg7 or B16 Atg7 -KO cells, and the percentage proliferation was measured by performing 3 independent experiments. ( K ) B16 Cas9 control or B16 Atg7 -KO cells (5 × 10 5 ) were injected into the flanks of C57BL6/J mice. After tumors reached a size of 50 mm 3 , mice were randomized to cohorts of n = 5 mice each, and B16 Cas9 control tumors were treated with IgG control + vehicle, anti–PD-1 Ab (200 μg i.p. every other day) + vehicle, IgG + HCQ (60 mg/kg i.p. daily), or the combination. B16 Atg7 -KO tumors were treated with either IgG control or anti–PD-1 Ab. The average growth rate ± SEM is shown. ( L ) Tumors and spleens were harvested from the experiment in B , on day 8 of treatment. The percentage of CD8 + T cells in CD45 + cells in spleen and tumor are shown. All t tests were 2 tailed ( G and K ). One-way ANOVA and Bonferroni’s adjustment ( B , C , and J ) or Dunnett’s procedure ( E and L ). E:T, effector/target; sgNT, single guide nontargeting.

Article Snippet: Ppt1 siRNA single duplex (OriGene, SR409088) CTGGTTGCAGGCTAGATTAGAGTTCAGGCTGAGCATGAACTATGTACATGGCTTGGAAGAGCTGTGGTTTCATGAACTCTGCTATAAAGTGCCAGGGCATCACTTAAGAAAAGGTATGATGTGGGCAGTAAACCATTCTTTAGATATTTGAAGATGGTCCCCTTCCTTAGCCAGAAACACTAGCTTTCCTGCTTTGTCCATTTTCTTTAGCCCCAGGCGGTCCTCTGTGTATAGAGTGCTCTCCTGGAGGGGAATGGTTTCCTTAGCTTGGCCACTTCTGTAAAATCCAAACCACTCAGAGTCGACAGGGTCCACAATGGAATCATTAAAGAATTTCACCATCACAAACTT.

Techniques: In Vitro, Western Blot, Enzyme-linked Immunosorbent Assay, Irradiation, Purification, Injection

Journal: JCI Insight

Article Title: PPT1 inhibition enhances the antitumor activity of anti–PD-1 antibody in melanoma

doi: 10.1172/jci.insight.133225

Figure Lengend Snippet: ( A ) Dot plot for the quantitative PCR (qPCR) expression in mouse macrophage RAW 264.7 cells polarized to an M2 phenotype following treatment with HCQ 10 μM or DC661 0.6 μM at the indicated time points (in hours) showing the results of 4 independent experiments. ( B ) Bright-field images of RAW 264.7 polarized to an M2 phenotype treated with HCQ or DC661 M1 phenotype control (IFN-γ + LPS). M2 cells have a round morphology whereas drug-treated M2 cells take on an elongated morphology with multiple pseudopodia typical of M1 macrophages (positive control). Images were taken at original magnification ×10. ( C ) Expression of M2 and M1 markers in mouse BMDMs treated with HCQ or DC661 as in A . Each result was reproduced by 3 independent experiments. ( D ) Dot plot showing qPCR expression of iNOS and RETNLA/FIZZ1 following Ppt1 KD in RAW 264.7 cells polarized to an M2 phenotype, and each result was reproduced by 5 independent experiments. Immunoblot showing the KD status of Ppt1 protein. ( E ) qPCR expression of M1 and M2 markers in Ulk1 -, Pik3c3 -, and Atg7 -KD conditions. Results were reproduced with 3 independent experiments. Immunoblots showing the KD status of Ulk1 , Pik3c3 , Atg7 protein and expression of LC3 and p62. ( F ) Schema of experimental setup and cytotoxicity elicited by primed splenocytes with or without exposure to MCM collected from RAW 264.7 macrophages treated with control HCQ or DC661 for 24 hours. ( G ) Immunophenotyping for M1/M2 ratio of TAMs and percentage PMN-MDSCs in B16 melanoma tumors after 8 days of treatment. Mean and SEM are representative of 4 to 5 replicates, and the experiment was repeated at least 3 times. A P value is presented for the test of the hypothesis that the addition of HCQ to anti–PD-1 Ab is significantly different compared with anti–PD-1 Ab + Veh; * indicates an adjusted P < 0.05 testing the hypothesis that each experimental group is different from control. All t tests were 2 tailed (1 sample in A and C , 2 sample in F and G ). One-way ANOVA and Dunnett’s procedure ( D and E ). Scale bar: 100 μm.

Article Snippet: Ppt1 siRNA single duplex (OriGene, SR409088) CTGGTTGCAGGCTAGATTAGAGTTCAGGCTGAGCATGAACTATGTACATGGCTTGGAAGAGCTGTGGTTTCATGAACTCTGCTATAAAGTGCCAGGGCATCACTTAAGAAAAGGTATGATGTGGGCAGTAAACCATTCTTTAGATATTTGAAGATGGTCCCCTTCCTTAGCCAGAAACACTAGCTTTCCTGCTTTGTCCATTTTCTTTAGCCCCAGGCGGTCCTCTGTGTATAGAGTGCTCTCCTGGAGGGGAATGGTTTCCTTAGCTTGGCCACTTCTGTAAAATCCAAACCACTCAGAGTCGACAGGGTCCACAATGGAATCATTAAAGAATTTCACCATCACAAACTT.

Techniques: Real-time Polymerase Chain Reaction, Expressing, Positive Control, Western Blot

Journal: JCI Insight

Article Title: PPT1 inhibition enhances the antitumor activity of anti–PD-1 antibody in melanoma

doi: 10.1172/jci.insight.133225

Figure Lengend Snippet: ( A ) Confocal microscopy of RAW 264.7 macrophages for staining calcium by Fluo-4, AM, dye in PPT1 inhibitor HCQ- and DC661-treated cells. Images were taken at original magnification ×40 under Olympus IX71 confocal microscope. ( B ) Immunoblots showing p-p38 and total p38 in DC661-, HCQ-, HDSF-, and LPS-treated RAW 264.7 macrophages. ( C ) Immunoblots for p-p38 and p38 in Ppt1 -KD condition in RAW 264.7 macrophages. ( D ) Immunoblot representing p-p65 and p65 in HCQ-, DC661-, and LPS-treated macrophages. ( E ) Immunoblots for p-p38 in HCQ or DC661 with cotreatment of p38 inhibitor SB203580 (5 μM) in macrophages. Dot plots representing qPCR expression in mouse macrophage RAW 264.7 cells polarized to an M2 phenotype following treatment with HCQ 10 μM or DC661 0.6 μM or cotreatment with p38 inhibitor as indicated. Each result was reproduced with 3 independent experiments. ( F ) Immunoblots for p-p38 in HCQ and DC661 or cotreatment with calcium chelator BAPTA-AM. ( G ) Immunoblots for p-p38 in HCQ and DC661 or cotreatment with calmodulin inhibitor W7. ( H ) Immunoblots for p-p38 in HCQ, DC661, or TRPML1 agonist MK6-83 or cotreatment with TRPML1 inhibitor verapamil. ( I ) Immunoblots for p-p38 in HCQ, DC661, or TRPML1 agonist MK6-83 or cotreatment with PIKfyve inhibitor vacuolin-1. ( J ) Immunoblot for p-p38 in DC661-treated cells or cotreatment of ER calcium channel inhibitor ryanodine or mitochondrial Na + /Ca 2+ exchanger inhibitor CGP37157. Immunoblot for p-p38 in TRPML1 agonist or cotreatment of ryanodine or CGP37157 in macrophages. Scale bar: 100 μm. * indicates P < 0.05. All t tests were 2 tailed and 2 sample.

Article Snippet: Ppt1 siRNA single duplex (OriGene, SR409088) CTGGTTGCAGGCTAGATTAGAGTTCAGGCTGAGCATGAACTATGTACATGGCTTGGAAGAGCTGTGGTTTCATGAACTCTGCTATAAAGTGCCAGGGCATCACTTAAGAAAAGGTATGATGTGGGCAGTAAACCATTCTTTAGATATTTGAAGATGGTCCCCTTCCTTAGCCAGAAACACTAGCTTTCCTGCTTTGTCCATTTTCTTTAGCCCCAGGCGGTCCTCTGTGTATAGAGTGCTCTCCTGGAGGGGAATGGTTTCCTTAGCTTGGCCACTTCTGTAAAATCCAAACCACTCAGAGTCGACAGGGTCCACAATGGAATCATTAAAGAATTTCACCATCACAAACTT.

Techniques: Confocal Microscopy, Staining, Microscopy, Western Blot, Expressing

Journal: JCI Insight

Article Title: PPT1 inhibition enhances the antitumor activity of anti–PD-1 antibody in melanoma

doi: 10.1172/jci.insight.133225

Figure Lengend Snippet: ( A ) Relative mass spectrometry signal of proteins in control, HCQ-treated, or DC661-treated MCM that showed a 5-fold increase and P < 0.05 in HCQ-treated MCM relative to control. ( B ) Dot plot representing ELISA performed for the measurement of IFN-β in HCQ- or DC661-treated MCM. Each result was obtained in duplicate, and the results were reproduced with 3 independent experiments. ( C ) Immunoblots showing cGAS, STING, and p-TBK1 protein status in macrophages treated with HCQ, DC661, or DMXAA for the time indicated. ( D ) Immunoblots for cGAS, STING, and p-TBK1 proteins in Ppt1 -KD macrophages. ( E ) Dot plots representing ELISA performed for the measurement of IFN-β in HCQ- or DC661-treated or STING inhibitor C-176 or TBK1 inhibitor GSK-8612 cotreated MCM. Each result was obtained in duplicates, and the results were reproduced with 3 independent experiments. ( F ) Immunoblot showing the status of p-STAT1 in isotype or anti–IFN-β neutralizing Ab in the presence or absence of recombinant IFN-β in mouse splenocytes. ( G ) Percentage cytotoxicity elicited by primed splenocytes with exposure to MCM collected from RAW 264.7 macrophages treated with control, HCQ, or DC661 along with the administration of isotype or anti–IFN-β neutralizing Ab as indicated. Each result was obtained in duplicates, and the results were reproduced with 3 independent experiments. ( H ) Schematic showing the PPT1 inhibition results in reduced MDSCs tumor infiltrations and macrophage M2 to M1 switching. Polarized macrophages upon PPT1 inhibition secrete IFN-β, which enhances the CD8 + T cell–mediated tumor cell killing. One-way ANOVA and Dunnett’s procedure ( B and E ) or Tukey’s procedure ( G ).

Article Snippet: Ppt1 siRNA single duplex (OriGene, SR409088) CTGGTTGCAGGCTAGATTAGAGTTCAGGCTGAGCATGAACTATGTACATGGCTTGGAAGAGCTGTGGTTTCATGAACTCTGCTATAAAGTGCCAGGGCATCACTTAAGAAAAGGTATGATGTGGGCAGTAAACCATTCTTTAGATATTTGAAGATGGTCCCCTTCCTTAGCCAGAAACACTAGCTTTCCTGCTTTGTCCATTTTCTTTAGCCCCAGGCGGTCCTCTGTGTATAGAGTGCTCTCCTGGAGGGGAATGGTTTCCTTAGCTTGGCCACTTCTGTAAAATCCAAACCACTCAGAGTCGACAGGGTCCACAATGGAATCATTAAAGAATTTCACCATCACAAACTT.

Techniques: Mass Spectrometry, Enzyme-linked Immunosorbent Assay, Western Blot, Recombinant, Inhibition